mlst.net | pacnes.mlst.net
 
DATA ANALYSIS
DATABASES
B.burgdorferi
B.cereus
B.henselae
B.pseudomallei
C.albicans
C.glabrata
C.krusei
C.tropicalis
C.jejuni
C.neoformans var grubii
E.coli
E.faecalis
E.faecium
H.influenzae
H.pylori
Leptospira spp.
M.catarrhalis
N.meningitidis
P.acnes
S.agalactiae
S.aureus
S.dysgalactiae
S.enterica
S.epidermidis
S.pneumoniae
S.pyogenes
S.suis
V.vulnificus
SUBMISSIONS
NEWS
LINKS
 

Propionibacterium acnes Organism specific information

Introduction

The Propionibacterium acnes MLST scheme was developed by Hans Lomholt and Mogens Kilian, Department of Medical Microbiology and Immunology, Aarhus University, Aarhus, Denmark.

The P. acnes database is curated by:

Professor Mogens Kilian,
Department of Medical Microbiology and Immunology,
Aarhus University,
Wilhelm Meyer’s alle 4
DK-8000 Aarhus C,
Denmark
Tel.: +45 8942 1735
Fax.: +45 8619 6128
E-mail: kilian@microbiology.au.dk

Lomholt H, Kilian M. 2010. Population genetic analysis of Propionibacterium acnes identifies a subpopulation and epidemic clones associated with acne..
PLoS ONE 5(8): e12277. doi:10.1371/journal.pone.0012277

 

Housekeeping genes and PCR primers

The P. acnes MLST scheme uses internal fragments of the following nine house-keeping genes:-

cel up - 5’ GCC GAC GTT TTC TAC AGT GAG C 3’
cel dn - 5’ GGC GGT GAG GGT CCA TTC A 3’
coa up - 5’ GCG GGA ATC GAG GGT GCT A 3’
coa dn - 5’ AGG GCC GCC GCT AGA TAA GTA 3’
fba up - 5’ AGG ACC CGC TAT TTC AAC TCT CA 3’
fba dn - 5’ ACG CGG GTC GTA CAT CTT CTT 3’
gms up - 5’ CCG CCT CAC CGT CCA GCA 3’
gms dn - 5’ CAC ATC GAG AAC CGC ATC ACTC 3’
lac up - 5’ GCC GCA GCC TTG GGA CTC T 3’
lac dn - 5’ GAA ATG CTG TCG CCC CGT G 3’
oxc up - 5’ GTG CTG CCG GAA AAG TCG 3’
oxc dn - 5’ CAC CGG CGT CAG GAT TGT 3’
pak up - 5’ CGACGC CTC CAA TAA CTT CC 3’
pak dn - 5’ GTC GGC CTC CTC AGC ATC 3’
recA up –-5´AGCTCGGTGGGGTTCTCTCATC 3´
recA dn --5´GCTTCCTCATACCACTGGTCATC 3´
zno up - 5’ CGC CGG CAT CAC CAC CTA TT 3’
zno dn - 5’ TCT CAC ATC GCC CGC AAC C 3’

cel (Transcription regulator CelR)
coa (O-succinylbenzoate-CoA synthase)
fba (Fructose bisphosphate aldolase)
gms (Glutamyl-tRNA synthetase)
lac (L-lactate dehydrogenase)
oxc (Cytochrome c oxidase subunit II)
pak (Pantothenate kinase)
recA (Recombinase A)
zno (Zn-dependant alcohol dehydrogenase)

PCR conditions for MLST housekeeping genes.

PCR amplification is carried out on crude chromosomal DNA.The recommended temperature profile for the PCR for 8 og the genes is an initial denaturation at 96° C for 40 s, followed by 35 cycles at 94° C for 35 s, 55º C for 40 s, and 72° C for 40 s, followed by a final extension at 72° C for 7 min. For the PCR for recA  the recommended temperature profile is an initial denaturation at 95° C for 3 min, followed by 35 cycles at 95° C for 1 min, 55º C for 30 s, and 72° C for 90 s, followed by a final extension at 72° C for 10 min.  Amplicons are purified using Nucleospin Extract II (Macherey-Nagel). Sequencing of both strands of the amplified fragments can be achieved with the same primers and the Thermo Sequenase dye terminator cycle sequencing kit (Amersham Life Science).

The database also includes allele sequences and allelic profiles of two putative virulence genes camp5 (CAMP factor 5) and tly (putative cytotoxin/hemolysin) previously used for typing of P. acnes. These genes are not included in the MLST scheme and sequence information for these genes is not required for submission of new profiles.

Camp5 and tly are amplified as described:

Valanne S, McDowell A, Ramage G, Tunney MM, Einarsson GG, et al. (2005) CAMP factor homologues in Propionibacterium acnes: a new protein family differentially expressed by types I and II. Microbiology 151: 1369–1379.

McDowell, Valanne S, Ramage G, Tunney MM, Glenn JV, et al. (2005) Propionibacterium acnes types I and II represent phylogenetically distinct groups. J Clin Microbiol 43: 326–334.


 
Profile Query

 
Locus Query

Batch Query